Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.160274 |
Chromosome: | chromosome 6 |
Location: | 1613665 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g260700 | XUV1,UAPA6 | (1 of 2) K06901 - putative MFS transporter, AGZA family, xanthine/uracil permease (pbuG); Xanthine/uracil/vitamin C permease-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCACAGCCGACTGCCGCGTCACTCACTCA |
Internal bar code: | CCCCGGTACCCGAGTCGGAGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 894 |
LEAP-Seq percent confirming: | 99.8441 |
LEAP-Seq n confirming: | 2562 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCCACAAAGATACGAACGC |
Suggested primer 2: | TAGTCACGTTCTGTCCTGCG |