| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.160323 |
| Chromosome: | chromosome 9 |
| Location: | 1713957 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396750 | CSE18 | Predicted protein of CSE family; (1 of 1) IPR000601//IPR022409 - PKD domain // PKD/Chitinase domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCTGCCAAGCCTGCGCCGTCGACCTCCC |
| Internal bar code: | ATACACAGTGTCCGTTGGTAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 356 |
| LEAP-Seq percent confirming: | 99.7922 |
| LEAP-Seq n confirming: | 5763 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTGGTGCTGGCTCTATGA |
| Suggested primer 2: | ATGAAGTACAAACCCGGCAG |