| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.160347 |
| Chromosome: | chromosome 7 |
| Location: | 4411739 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g340900 | (1 of 1) PTHR31223//PTHR31223:SF11 - FAMILY NOT NAMED // LOG FAMILY PROTEIN YJL055W | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATCCCTGCAACCCCCCTCCGTTCCGCTT |
| Internal bar code: | CAGCTTGTAGATTCGCTAGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 376 |
| LEAP-Seq percent confirming: | 68.8487 |
| LEAP-Seq n confirming: | 12295 |
| LEAP-Seq n nonconfirming: | 5563 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTAGCCCAAACCAAACCG |
| Suggested primer 2: | GCAAACGGGACGTGTAAAGT |