| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.160424 |
| Chromosome: | chromosome 12 |
| Location: | 9436905 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g539750 | (1 of 1) PF09649 - Histone chaperone domain CHZ (CHZ) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCGGTCCCGGGCGGGGTGGCTCACTTGA |
| Internal bar code: | CCACCGGCCTCGACTTCCCTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 115 |
| LEAP-Seq percent confirming: | 99.8855 |
| LEAP-Seq n confirming: | 872 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGAGCGAGACCTAGTTGAC |
| Suggested primer 2: | TCTGTTTTGCCCACACACAT |