| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.160605 |
| Chromosome: | chromosome 3 |
| Location: | 642528 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145787 | HSP22C | (1 of 1) IPR000104//IPR002068//IPR008978//IPR031107 - Antifreeze protein, type I // Alpha crystallin/Hsp20 domain // HSP20-like chaperone // Small heat shock protein HSP20; Heat shock protein 22C | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTACTCGCTGAGTCGCTGCAGCTCGTGC |
| Internal bar code: | TCGGCCGGATCTAGTGGGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 440 |
| LEAP-Seq percent confirming: | 99.7093 |
| LEAP-Seq n confirming: | 3087 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAAGTGATTCCATGCTGGG |
| Suggested primer 2: | ATAGATGGCAACCGATGGAG |