| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.160617 |
| Chromosome: | chromosome 11 |
| Location: | 1411767 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467723 | KAS1 | (1 of 1) PTHR11712//PTHR11712:SF226 - POLYKETIDE SYNTHASE-RELATED // 3-OXOACYL-[ACYL-CARRIER-PROTEIN] SYNTHASE I, CHLOROPLASTIC; 3-ketoacyl-ACP-synthase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCATTCGCGCGCAAGCAGCTGCGGAAGG |
| Internal bar code: | TCGGTGCCACTAACCCGCTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 521 |
| LEAP-Seq percent confirming: | 99.5261 |
| LEAP-Seq n confirming: | 210 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCTCGTATGCAAAAATGC |
| Suggested primer 2: | AACGGATCAGCGGATATGAC |