| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.160643 |
| Chromosome: | chromosome 1 |
| Location: | 5729412 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g040850 | (1 of 1) IPR002048//IPR003368//IPR006626//IPR010308//IPR011050 - EF-hand domain // Polymorphic outer membrane protein repeat // Parallel beta-helix repeat // TRP-like family // Pectin lyase fold/virulence factor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGGTGGCGCTGCTGGGCAGACCCGTGGC |
| Internal bar code: | CCTTTTTGAACGATTTGCCCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 549 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCTATGCCGTTGACATTG |
| Suggested primer 2: | TTGCTGCTGCTACTGCTGTT |