Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.160647 |
Chromosome: | chromosome 1 |
Location: | 6068485 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g043250 | (1 of 3) PTHR30570:SF0 - PHOSPHATE-BINDING PROTEIN PSTS | 5'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAATCACGAGCGCAGCCTTGTACTGAACC |
Internal bar code: | CACCCCCCAATCCACATGGCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 788 |
LEAP-Seq percent confirming: | 99.8708 |
LEAP-Seq n confirming: | 773 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTGGGAGGACAGTTTGTGG |
Suggested primer 2: | CTATTGCTGAGCCCGTAAGC |