| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.160744 |
| Chromosome: | chromosome 13 |
| Location: | 4730831 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g604750 | CGL94 | zinc finger family protein; (1 of 37) PF13639 - Ring finger domain (zf-RING_2) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTTTGCCAGGCCAGCAAACGCTGGATAA |
| Internal bar code: | GACAATGGGAACACGCTCGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 964 |
| LEAP-Seq percent confirming: | 99.2441 |
| LEAP-Seq n confirming: | 1313 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTGTCAGGCCGTTATGTG |
| Suggested primer 2: | GCCAAGGCGAGTAAGAGATG |