| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.160790 |
| Chromosome: | chromosome 12 |
| Location: | 7484257 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g556050 | PRPL9 | Chloroplast ribosomal protein L9; (1 of 1) K02939 - large subunit ribosomal protein L9 (RP-L9, MRPL9, rplI) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAGCTGGAGGCAGCGGCTGCGCTGCGCT |
| Internal bar code: | GGTGAGCCTTATCGCGCGCTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1117 |
| LEAP-Seq percent confirming: | 99.5334 |
| LEAP-Seq n confirming: | 2133 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGACATCAGCATGTCGCAAG |
| Suggested primer 2: | AAGAAGCTGGAGGAGAAGGC |