| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.160805 |
| Chromosome: | chromosome 16 |
| Location: | 394327 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g693601 | ISG-C2,ISG2 | (1 of 5) PTHR16631//PTHR16631:SF9 - FAMILY NOT NAMED // GLUCAN 1,3-BETA-GLUCOSIDASE; Hydroxyproline-rich cell wall protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACCCCTTCCAACCGCCCCCCCCCCCCC |
| Internal bar code: | CCCGAGCTGCAGTGTACAAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 225 |
| LEAP-Seq percent confirming: | 99.8186 |
| LEAP-Seq n confirming: | 7154 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACCAGGTTGATAGCGTCC |
| Suggested primer 2: | AGGAGAGGGAGAAGGAGACG |