| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.160855 |
| Chromosome: | chromosome 6 |
| Location: | 7684681 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g301800 | MFT19 | Major facilitator superfamily transporter; (1 of 2) PF05977 - Transmembrane secretion effector (MFS_3) | 3'UTR|3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTGGCACCCAGGCTGCTTTCCGCACGCA |
| Internal bar code: | GGTTTTCGAATGCAGTATTTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 751 |
| LEAP-Seq percent confirming: | 98.5303 |
| LEAP-Seq n confirming: | 1676 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTTCGACGTGCTAAAAGG |
| Suggested primer 2: | CAAGGTCGCTTCAACTCACA |