| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.160860 |
| Chromosome: | chromosome 12 |
| Location: | 1290150 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g489050 | PCT2,CDS2 | Phosphatidate cytidylyltransferase; (1 of 1) PTHR13773:SF3 - PHOSPHATIDATE CYTIDYLYLTRANSFERASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGCAAATACCAGGCCCTCAGCCCCGGTA |
| Internal bar code: | TCGTAGCACGCGAAGGGCGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 950 |
| LEAP-Seq percent confirming: | 98.227 |
| LEAP-Seq n confirming: | 277 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCTGAAGAACACCATGA |
| Suggested primer 2: | TCCTTGTTCGGCCTCTTCTA |