Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.160883 |
Chromosome: | chromosome 13 |
Location: | 1375102 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g571800 | (1 of 4) PF07059 - Protein of unknown function (DUF1336) (DUF1336) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCGAGTCGTGCCGTGCCGTGCCTTGCCA |
Internal bar code: | GGTTTTTACCTGGAGCTTGTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 626 |
LEAP-Seq percent confirming: | 88.3238 |
LEAP-Seq n confirming: | 33155 |
LEAP-Seq n nonconfirming: | 4383 |
LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGACCTTTGAAAACCAGAC |
Suggested primer 2: | AGGAAGGTTCTGGTGTGGTG |