Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.160885 |
Chromosome: | chromosome 14 |
Location: | 3758278 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g632300 | HDA6 | (1 of 2) PTHR10625//PTHR10625:SF131 - HISTONE DEACETYLASE // SUBFAMILY NOT NAMED; RPD3/HDA1 type histone deacetylase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGCGGGGAAGTTGGAGGCGGCGTGTACG |
Internal bar code: | GGGAAAGGGCCACGGTGCGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 290 |
LEAP-Seq percent confirming: | 99.2278 |
LEAP-Seq n confirming: | 514 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCTATGTGCATGTCGTCTG |
Suggested primer 2: | TCACTCAGTGGGTAGGGGAC |