| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.160888 |
| Chromosome: | chromosome 8 |
| Location: | 4587908 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g383150 | ROC97,NAT3,NAT5 | N-acetyl-transferase 3; (1 of 1) K17972 - N-terminal acetyltransferase B complex catalytic subunit [EC:2.3.1.88] (NAA20, NAT3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTAGGTTGGGCTGGTATTTACAACCCCT |
| Internal bar code: | TTGTCATGCCCGCTTGTCTATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 252 |
| LEAP-Seq percent confirming: | 99.5006 |
| LEAP-Seq n confirming: | 797 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTGCACCAATGTGTGTCC |
| Suggested primer 2: | AGGAATGTTAGAGAGCGCCA |