Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.160914 |
Chromosome: | chromosome 2 |
Location: | 84654 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g073750 | KIN9-2,KLP1 | Kinesin motor protein; (1 of 3) K10397 - kinesin family member 6/9 (KIF6_9) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTTGACAGTAGGAAGCTCGTGAGCGTGT |
Internal bar code: | GCGGTGGCATGGCGGTGTGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1053 |
LEAP-Seq percent confirming: | 99.4921 |
LEAP-Seq n confirming: | 1763 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGAATGATTGAAACAGCCCG |
Suggested primer 2: | CCTCACCCTAGCTTGTCAGC |