| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.160923 |
| Chromosome: | chromosome 12 |
| Location: | 1100591 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g490700 | MIN1 | (1 of 1) IPR000008//IPR018392 - C2 domain // LysM domain; Mini-eyespot protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGTCGCACAGACGCACACTACGGCTGCC |
| Internal bar code: | GTAAGGCATCGAGGCCATGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 915 |
| LEAP-Seq percent confirming: | 99.9538 |
| LEAP-Seq n confirming: | 2162 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTTAAGCCCTTGTCGGTG |
| Suggested primer 2: | TCGGTGTTTGATGACATCGT |