Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.160930 |
Chromosome: | chromosome 5 |
Location: | 2712871 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g236802 | (1 of 71) IPR016181 - Acyl-CoA N-acyltransferase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACTACGCGGCTGCCGCAGCCTACCAGT |
Internal bar code: | TATGGGCATGTCACCGCGTCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 216 |
LEAP-Seq percent confirming: | 98.8365 |
LEAP-Seq n confirming: | 1529 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAAGGCCTTAGACAGGGCAT |
Suggested primer 2: | ACTATCCACTGCCACCGAAC |