| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.160990 |
| Chromosome: | chromosome 13 |
| Location: | 5170796 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g607800 | (1 of 29) IPR013320 - Concanavalin A-like lectin/glucanase domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATCGGCGCCAACAGCGCCTCAGTAAGGCT |
| Internal bar code: | GAGAGGTCAGTACATAGATACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 753 |
| LEAP-Seq percent confirming: | 98.9686 |
| LEAP-Seq n confirming: | 2015 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAAACACCCACTTCATGT |
| Suggested primer 2: | GTGAGCAGCATGAAGAGCAG |