Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.161062 |
Chromosome: | chromosome 2 |
Location: | 6020961 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g112400 | CHI1 | (1 of 1) K12310 - Di-N-acetylchitobiase (CTBS); Chitinase-like hydrolase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATTTGGTCCTGGCCATGCATCCCACCTG |
Internal bar code: | GGGTGGGCCAGTGTTCGGCGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 626 |
LEAP-Seq percent confirming: | 93.2836 |
LEAP-Seq n confirming: | 125 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACCCTCCCATAAGAGCAAA |
Suggested primer 2: | GTGCATGTATTGCAGATGGG |