| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.161163 |
| Chromosome: | chromosome 16 |
| Location: | 4739625 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g686800 | PTA2 | (1 of 10) IPR005828//IPR020846 - Major facilitator, sugar transporter-like // Major facilitator superfamily domain; Proton/phosphate symporter, splice variant b | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCGGTCCCCGTGTGGGCCTTGCATGTCT |
| Internal bar code: | TCCGGTACCGCGATGAGTAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 960 |
| LEAP-Seq percent confirming: | 99.0237 |
| LEAP-Seq n confirming: | 1420 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCGTTCCAACACCGAAAC |
| Suggested primer 2: | GTAACGCGGAGCAGTAAAGC |