| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.161170 |
| Chromosome: | chromosome 16 |
| Location: | 6811290 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g674852 | HAP2,GCS1 | (1 of 1) PF10699 - Male gamete fusion factor (HAP2-GCS1); Generative cell specific-1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGCAGGACGGCGACTGGGAGGACTCGCC |
| Internal bar code: | TGTTGTCTGCAATGTGTCGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 610 |
| LEAP-Seq percent confirming: | 99.8623 |
| LEAP-Seq n confirming: | 1450 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTATATTCTTGCGCACGCTG |
| Suggested primer 2: | ACACAGACATAGGGAAGGCG |