| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.161228 |
| Chromosome: | chromosome 6 |
| Location: | 2445811 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g268650 | FAP279 | (1 of 8) PF14580 - Leucine-rich repeat (LRR_9); Flagellar Associated Protein 279 | 5'UTR|CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGACGAACACCTCGAATCCGCGCAGTTT |
| Internal bar code: | CACCTGTACGTAGTGCGCGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 479 |
| LEAP-Seq percent confirming: | 99.4709 |
| LEAP-Seq n confirming: | 188 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCGTTAACCAGCTCATCC |
| Suggested primer 2: | GCCAGGAAGTTGAGACAAGC |