| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.161284 |
| Chromosome: | chromosome 3 |
| Location: | 166209 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g144204 | (1 of 2) PTHR10219 - GLYCOLIPID TRANSFER PROTEIN-RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGCTCCGCCTCCGCCTGCAGTCCGCCC |
| Internal bar code: | TAGCCCACGAGGGCGTGGAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 469 |
| LEAP-Seq percent confirming: | 90.0369 |
| LEAP-Seq n confirming: | 732 |
| LEAP-Seq n nonconfirming: | 81 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTGGATGATACAGTGTGC |
| Suggested primer 2: | TGGAACTCAAGCCCACTACC |