Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.161387 |
Chromosome: | chromosome 6 |
Location: | 2453495 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g268750 | MME1,MME | (1 of 1) 1.1.1.39 - Malate dehydrogenase (decarboxylating) / Pyruvic-malic carboxylase; Malate dehydrogenase 1, decarboxylating | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCCCGCCTCCCCGCCACCCACATCAGGC |
Internal bar code: | CCGGTTGCTGCGCTGGAAACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 728 |
LEAP-Seq percent confirming: | 99.3983 |
LEAP-Seq n confirming: | 9582 |
LEAP-Seq n nonconfirming: | 58 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCCTGACACGCACATACGA |
Suggested primer 2: | GCTGTTACAAGGGGTACGGA |