Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.161388 |
Chromosome: | chromosome 7 |
Location: | 5956120 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g354500 | HSF2 | (1 of 2) K09419 - heat shock transcription factor, other eukaryote (HSFF); Heat shock transcription factor 2 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGCATGCCAATGACGGCAGCACCCATTG |
Internal bar code: | GGTGGTACTCAGGCGCAGATCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1070 |
LEAP-Seq percent confirming: | 99.3286 |
LEAP-Seq n confirming: | 2811 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGCCAGCTAGGCTATGTC |
Suggested primer 2: | GCGTTTCTGGTACGGTGAAT |