| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.161467 |
| Chromosome: | chromosome 7 |
| Location: | 2197739 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g327079 | (1 of 2) IPR002563//IPR012349 - Flavin reductase like domain // FMN-binding split barrel | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAAGTGCAAACAAGCGACGTGAATCGTC |
| Internal bar code: | AAAGTTTAGGGTCAAATTGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1003 |
| LEAP-Seq percent confirming: | 99.6639 |
| LEAP-Seq n confirming: | 4448 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTTGAAGAAGCTGTAGGG |
| Suggested primer 2: | CTACAGCAATGAGCCGATGA |