| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.161488 |
| Chromosome: | chromosome 1 |
| Location: | 3751641 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g024250 | HEL4 | DEAH box ATP-dependent RNA helicase; (1 of 1) 1.14.13.101 - Senecionine N-oxygenase / Senecionine monooxygenase (N-oxide-forming) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATCGGCAGCGCCGCCGTAACGGACGTGGC |
| Internal bar code: | AGTGGAACAGTGGGCATATCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 504 |
| LEAP-Seq percent confirming: | 96.4235 |
| LEAP-Seq n confirming: | 674 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAACCGTACGGCAGCTGAT |
| Suggested primer 2: | GAGCACCCGTCAGAGTCTTT |