Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.161500 |
Chromosome: | chromosome 2 |
Location: | 3356220 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095097 | FKB21,FKB17-2,FKB17B | (1 of 2) PTHR10516:SF290 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE; peptidyl-prolyl cis-trans isomerase, FKBP-type | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGCCATGCCAGTTTTTAAGTGATGGCTT |
Internal bar code: | ATGGATTCGTGAATTTGTGAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 397 |
LEAP-Seq percent confirming: | 99.8088 |
LEAP-Seq n confirming: | 2088 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGAATTGGAGCAGACACA |
Suggested primer 2: | CTTTCCCTGAGCGACAAGAC |