| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.161547 |
| Chromosome: | chromosome 16 |
| Location: | 4390080 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g671300 | (1 of 3) K12041 - solute carrier family 9 (sodium/hydrogen exchanger), member 6/7 (SLC9A6_7, NHE6_7) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACACGCGCAATATGCTGAACACGTGTCCA |
| Internal bar code: | ACGACGTGACTAACAGTCTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 593 |
| LEAP-Seq percent confirming: | 98.9894 |
| LEAP-Seq n confirming: | 7346 |
| LEAP-Seq n nonconfirming: | 75 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATTTCAAAAGGCCAGCAT |
| Suggested primer 2: | ACAGTAGCAGCGGCAGGTAT |