| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.161579 |
| Chromosome: | chromosome 11 |
| Location: | 3776562 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g483200 | (1 of 2) PTHR31350//PTHR31350:SF1 - FAMILY NOT NAMED // F-BOX ONLY PROTEIN 21 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGCCCGCCCCCGGCCCGAACCCCGAAC |
| Internal bar code: | ATACTCGCTTGTTTGCGCCACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 863 |
| LEAP-Seq percent confirming: | 73.2426 |
| LEAP-Seq n confirming: | 1292 |
| LEAP-Seq n nonconfirming: | 472 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGATCTACAAGGGGGCAA |
| Suggested primer 2: | AACTGGGTGGAACTTGATGC |