| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.161580 |
| Chromosome: | chromosome 17 |
| Location: | 4932096 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g734548 | PPD2 | Pyruvate phosphate dikinase; (1 of 1) 2.7.11.32//2.7.9.1 - [Pyruvate, phosphate dikinase] kinase / Pyruvate, phosphate dikinase regulatory protein // Pyruvate, phosphate dikinase / Pyruvate,phosphate dikinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACTGCCACCCCGCTATACCACGCCTGAC |
| Internal bar code: | GTTCACGTATCCGACAAAGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 954 |
| LEAP-Seq percent confirming: | 99.7874 |
| LEAP-Seq n confirming: | 2816 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACCCAACAGGTGCTCGAC |
| Suggested primer 2: | AACACTCCAAACAGGCCAAC |