Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.161590 |
Chromosome: | chromosome 7 |
Location: | 4092219 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g340600 | MCP21 | Mitochondrial substrate carrier protein; (1 of 2) IPR000104//IPR018108//IPR023395 - Antifreeze protein, type I // Mitochondrial substrate/solute carrier // Mitochondrial carrier domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGACCTGTGACTCTTCTGCTCTGCGCCCA |
Internal bar code: | CGCAGTCCACTTGTGTTGTGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 212 |
LEAP-Seq percent confirming: | 42.1053 |
LEAP-Seq n confirming: | 472 |
LEAP-Seq n nonconfirming: | 649 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGGAAGCTGTGGCTTTAGG |
Suggested primer 2: | CATATACGGCGTGCATTGTC |