| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.161642 |
| Chromosome: | chromosome 12 |
| Location: | 5822248 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g533500 | (1 of 7) PF00211//PF13416 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Bacterial extracellular solute-binding protein (SBP_bac_8) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGTTCTGCCTGCAGGTCCAGTCCGACCT |
| Internal bar code: | ACTACGTTCCGCTTTTACGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 448 |
| LEAP-Seq percent confirming: | 90.6318 |
| LEAP-Seq n confirming: | 1248 |
| LEAP-Seq n nonconfirming: | 129 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTAGACTTGTCGTGCCCTC |
| Suggested primer 2: | GCTGTCCAGGTGCAGGTAAT |