Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.161647 |
Chromosome: | chromosome 14 |
Location: | 1237702 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g616350 | FAS4 | Fasciclin-like protein 4; (1 of 10) PTHR10900 - PERIOSTIN-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACAGCGGGTGCACCGGCAGCAGTGGGAGC |
Internal bar code: | AGCTCCTTGTTGGCAACGTCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1 |
LEAP-Seq percent confirming: | 99.8626 |
LEAP-Seq n confirming: | 6542 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTGGGCCAGTACCTCACT |
Suggested primer 2: | TTTCGTCTCTCATCACGCAC |