| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.161664 |
| Chromosome: | chromosome 1 |
| Location: | 5701881 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g040600 | FAP327 | Flagellar Associated Protein 327; (1 of 3) PTHR18937//PTHR18937:SF254 - STRUCTURAL MAINTENANCE OF CHROMOSOMES SMC FAMILY MEMBER // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGTGACCGACCCCGCCTTCCTCCGCCC |
| Internal bar code: | GTGGTTAGGGGGTTTTGGCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 400 |
| LEAP-Seq percent confirming: | 99.8152 |
| LEAP-Seq n confirming: | 540 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGGAGATGTTTACGGTCG |
| Suggested primer 2: | CATAGATGTTGAGAGCGGCA |