| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.161743 |
| Chromosome: | chromosome 9 |
| Location: | 450303 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g404450 | MCP24 | Mitochondrial substrate carrier protein; (1 of 1) IPR000104//IPR002067//IPR018108//IPR023395 - Antifreeze protein, type I // Mitochondrial carrier protein // Mitochondrial substrate/solute carrier // Mitochondrial carrier domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTGCTAATGGTGCTTGCGTGTGTCAGTG |
| Internal bar code: | GGTTCCTCGTCCGTAGGCGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 220 |
| LEAP-Seq percent confirming: | 93.2013 |
| LEAP-Seq n confirming: | 1741 |
| LEAP-Seq n nonconfirming: | 127 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCGTCTCAGATAGACACCA |
| Suggested primer 2: | GACAGCGCTTACAATCGACA |