| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.161759 |
| Chromosome: | chromosome 16 |
| Location: | 3168531 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g666100 | (1 of 1) K14168 - cytoplasmic tRNA 2-thiolation protein 1 (CTU1, NCS6) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACATTATGCAGGCATCCAATAGCCTCAG |
| Internal bar code: | GAGCGGGGAGAAAGTGGATGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1073 |
| LEAP-Seq percent confirming: | 99.6444 |
| LEAP-Seq n confirming: | 2802 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTTCTAGTGGCACCATGT |
| Suggested primer 2: | ACCACAGCTACGGATTGGAC |