| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.161761 |
| Chromosome: | scaffold 24 |
| Location: | 68303 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre24.g755597 | Chlorophyll a /Pheophorbide a oxygenase-related protein; (1 of 2) 1.14.13.122 - Chlorophyllide-a oxygenase / Cholorophyll-b synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTCGCGGCGCCACTCCTTGTTTTGCCAG |
| Internal bar code: | TCGCTACAGCTTAATGCCACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 703 |
| LEAP-Seq percent confirming: | 99.7543 |
| LEAP-Seq n confirming: | 406 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGGTGAACCCAACCATAAT |
| Suggested primer 2: | AAAGATGTGGGTCTGGAACG |