Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.161788 |
Chromosome: | chromosome 2 |
Location: | 6805414 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g118850 | (1 of 1) K08762 - diazepam-binding inhibitor (GABA receptor modulator, acyl-CoA-binding protein) (DBI, ACBP) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGCCCAAGGGCCCTCGGCTTTCGAGTTC |
Internal bar code: | GGGGTAGATGGGTGGCGCGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 642 |
LEAP-Seq percent confirming: | 98.6897 |
LEAP-Seq n confirming: | 3314 |
LEAP-Seq n nonconfirming: | 44 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCCTGTCTGACCACCTGTC |
Suggested primer 2: | CTCATACTCCTCCTCCTGCG |