Insertion junction: LMJ.RY0402.161794_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.161794
Chromosome:chromosome_8
Location:4151482
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CTGGCGGCGGGGAGCATATCCTCAGATGAC
Internal bar code:CAGGGGTGCTTTTCGCGAGGTA

Confirmation - LEAP-Seq

LEAP-Seq distance:562
LEAP-Seq percent confirming:55.2182
LEAP-Seq n confirming:582
LEAP-Seq n nonconfirming:472
LEAP-Seq n unique pos:12

Suggested primers for confirmation by PCR

Suggested primer 1:TTTTCCTGTGCTTTCCTGCT
Suggested primer 2:TTGTAACGACAGCTTGCGAC