Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.161834 |
Chromosome: | chromosome 8 |
Location: | 250389 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g358554 | (1 of 14) 3.1.3.16//3.1.3.48 - Protein-serine/threonine phosphatase / Serine/threonine specific protein phosphatase // Protein-tyrosine-phosphatase / PTPase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTAGCGTGCCACCTTACGAGACAGAGATA |
Internal bar code: | AAGATAGGGGGGGGTGACTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 619 |
LEAP-Seq percent confirming: | 94.3662 |
LEAP-Seq n confirming: | 134 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGATCATCGAAACCCTGCAC |
Suggested primer 2: | GTGTGTGCATCATGAAAGGG |