| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.161836 |
| Chromosome: | chromosome 13 |
| Location: | 3380627 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g586916 | SCL27,SRS6,SRS9 | Serine/arginine-rich pre-mRNA splicing factor; (1 of 2) K12900 - FUS-interacting serine-arginine-rich protein 1 (FUSIP1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGGATGGACCTTGTTGCGCACGCAGGCA |
| Internal bar code: | TTTTTCGCTAATGAGGACTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1180 |
| LEAP-Seq percent confirming: | 99.3648 |
| LEAP-Seq n confirming: | 3911 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTTGATTCCATCTCTGCCG |
| Suggested primer 2: | ACACTTGATTTGGAAACCGC |