Insertion junction: LMJ.RY0402.161886_3

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.161886
Chromosome:chromosome 9
Location:4901726
Confidence (%):95
Locus systematic id Locus common name Defline Feature
Cre09.g397845 intron

Insertion site details

Expected flanking sequence (starting at cassette; orientation from cassette outwards): GCTCCCACATCCAATACCAGACCAGGCCAG
Internal bar code:CAGGGCGGAGGATTGCCTACTT

Confirmation - LEAP-Seq

LEAP-Seq distance:566
LEAP-Seq percent confirming:81.6393
LEAP-Seq n confirming:1494
LEAP-Seq n nonconfirming:336
LEAP-Seq n unique pos:20

Suggested primers for confirmation by PCR

Suggested primer 1:CGCTCCAAACATCTCACAGA
Suggested primer 2:ACACACTACCCCGAGATTGC