Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.161963 |
Chromosome: | chromosome 4 |
Location: | 2796125 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g223900 | (1 of 2) K09313 - homeobox protein cut-like (CUTL) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCCGGATGCGTTGCCCACCTTGTGCCAT |
Internal bar code: | CCCACCGTACCAAGCAAGCTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 205 |
LEAP-Seq percent confirming: | 54.6626 |
LEAP-Seq n confirming: | 2884 |
LEAP-Seq n nonconfirming: | 2392 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCATTCACACGAAGGAGCC |
Suggested primer 2: | GAGAAGAGTGAGTGGTGGGC |