| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.161988 |
| Chromosome: | chromosome 12 |
| Location: | 7278941 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g557800 | (1 of 1) K06875 - programmed cell death protein 5 (PDCD5, TFAR19) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTTGAGCACGCACACAACTCAGCCAGTT |
| Internal bar code: | GCACTACCAGAGTCGGGTGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 206 |
| LEAP-Seq percent confirming: | 2.01422 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 827 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGATACCCGTGTGCTCCTT |
| Suggested primer 2: | AATAGATGTTGAGGCCGTGG |