| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.161997 |
| Chromosome: | chromosome 6 |
| Location: | 5259432 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g282450 | PFH18,PHX11 | (1 of 1) PTHR10869//PTHR10869:SF91 - PROLYL 4-HYDROXYLASE ALPHA SUBUNIT // SUBFAMILY NOT NAMED; Putative prolyl 4-hydroxylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGCCCGGTGCGCCCCTGCCCGCCACCC |
| Internal bar code: | GGTAGCAGTCATGGGGGACCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 93 |
| LEAP-Seq percent confirming: | 48.307 |
| LEAP-Seq n confirming: | 214 |
| LEAP-Seq n nonconfirming: | 229 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGTGGGTCAGGATGTGAA |
| Suggested primer 2: | GATACAATAATCAGGCCGGG |