Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.162081 |
Chromosome: | chromosome 17 |
Location: | 6604900 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g743547 | (1 of 16) IPR003439//IPR003593//IPR013525//IPR027417 - ABC transporter-like // AAA+ ATPase domain // ABC-2 type transporter // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCACAGCAGCCAGGCGGCTCTGGACGT |
Internal bar code: | GGGCCCCGAGAGGGGTAAAGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1121 |
LEAP-Seq percent confirming: | 99.5415 |
LEAP-Seq n confirming: | 4342 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGCCTAACGCGTATCTTG |
Suggested primer 2: | AGTCCCGCCATGAAGTACAC |