| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.162097 |
| Chromosome: | chromosome 4 |
| Location: | 3870205 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g230340 | FAP206 | (1 of 1) PTHR21442:SF0 - UPF0704 PROTEIN C6ORF165; Flagellar Associated Protein 206 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGTTTGGGGGGGGGGGAATTACCAGCC |
| Internal bar code: | TTGGCCCACGCTCATCCGGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 464 |
| LEAP-Seq percent confirming: | 88.1348 |
| LEAP-Seq n confirming: | 3922 |
| LEAP-Seq n nonconfirming: | 528 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACCAAGTTACACTGGCGG |
| Suggested primer 2: | TACCAGCCCAAACTAAACCG |